Table of Contents
Introduction
For many years, researchers have searched for ways to alter human’s genetic makeup. Through genome editing, scientists hope to be able to control the characteristics of the human body, like “editing out” harmful genes that affect genetic diseases. Though several methods of genome editing have been discovered and improved upon, CRISPR-Cas9 is an approach that holds great potential.
CRISPR-Cas9 is a system made to replicate a system in bacteria that naturally edits genomes. In the lab, a small piece of RNA is created with a “guide” sequence that binds to a specific sequence of DNA in the genome. The RNA also binds to the enzyme, Cas9. The Cas9 enzyme is then able to identify the targeted DNA sequence and cut it. After the DNA is cut, there are two favored processes used to modify the genome. The first is called non-homologous end-joining (NHEJ), the other is called homology-directed repair (HDR). NHEJ, the more conventional technique, is used to knock-out a gene of interest into a cell line. HDR, the more technically challenging method, is used to knock-in a point mutation (often a mutation associated with a certain disease) into a cell line.
Despite the high interest and experimentation with CRISPR in the last several years, the HDR pathway remains very inefficient. HDR requires a large piece of donor DNA to be inserted into the targeted gene. Precise amounts of CRISPR, Cas9, and donor DNA are transfected into a collection of iPSCs, but the amount of iPSCs that express the mutation afterwards is low. One possible solution to this problem lies in the addition of small molecules to the CRISPR process. This project will add a unique mixture of small molecules to the CRISPR-Cas9 and test if the molecules increase the efficiency of the HDR pathway.
127 our experts are availableright now
Significance and Literature Review
CRISPR technology can be used to study a vast number of topics, and the condition being studied affects the DNA sequence that is targeted as well as the point mutation made. In this project, the point mutation will change the ATG sequence on exon 4 of a wild type NFATC1 gene to TTG, changing Methionine to Leucine. This gene was chosen because NFATC1 polymorphisms may affect congenital heart disease in children (Li et al, 2017). If the CRISPR works, sequencing will show the point mutation and the mutant cells could be studied by Dr. Tristani’s lab and others to learn more about the link between NFATC1 and certain heart conditions.
The use of CRISPR to help study and fight, diseases is an idea that has been present in the scientific community for some time. In 2015, one investigator researcged using CRISPR to create in vivo models of complex diseases such as cancer (Dow, 2015). More recently, an article was published in March of this year discussing the newest research and breakthroughs Harvard and other colleges have found for CRISPR mutations being used to fight disease (Boettner, 2018). The University of Utah could benefit greatly by staying involved in CRISPR research and contributing to the shared knowledge between other academic institutions.
While the investigators above focused on the potential uses of HDR CRISPR, other researchers have studied ways to improve the CRISPR process itself. Though a popular technology, CRISPR is very inefficient, yielding the desired mutant alleles at an estimated rate of ~1-5% (Wang et al, 2017). This may be due in part to the NHEJ pathway, which can quickly repair any double-stranded breaks the Cas9 enzyme creates in DNA.
Small molecules have been reported to inhibit the NHEJ pathway, and in doing so, could potentially increase the efficiency of HDR CRISPR editing (Yu, 2015). In this project, a mixture of SCR7 and L755507 will be added to the iPSCs during the CRISPR process to see if the small molecules help increase the efficiency of cutting the target sequence and/or increase the efficiency of the HDR knock-in pathway. These molecules were chosen because other studies have previously experimented with L7 and SCR7 and claimed to see a higher efficiency rates during the CRISPR process using fibroblast cells (Li et al 2017).
Genome-editing in iPSCs is cutting-edge technology, and this project will help contribute to the scientific community’s understanding of CRISPR. Any successful mutant cells that result from the study can be moved to Dr. Tristani’s lab for further study of the NFATC1 gene. Additionally, if the results conclude that small molecules do help increase efficiency, every lab at the U that works with iPSCs or genome editing will benefit from the knowledge and have access to a cutting-edge scientific process.
Materials and Methods
gRNA: Binds to DNA target sequence and Cas9 enzyme. The gRNA Option 1 has cleavage site 6nt from edited site (5’ACGGCTCGCATGCTGTTCTC 3’). The gRNA Option 2 has a cleavage site 10nt from edited site (5’ CTCGCATGCTGTTCTCCGGC 3’)
- Donor DNA: Synthetic oglionucleotide containing 80bp of DNA. Single stranded
- Point Mutation: Aiming to change the wild-type sequence TTG on exon 4 of NFATC1 to ATG
- Small Molecule Mixture: 6.3/3.6 Scr7/L755507
- Electroporation: The NEON Electroporation System will be used to deliver the CRISPR-Cas9 and Donor DNA into iPSCs
- iPSC Culture: Standard culturing methods will be used. iPSCs will be kept on vitronectin-coated plates in Steflex media.
- Cleavage Detection Kit: PCR will amplify gene-specific double-strand breaks. Denaturing and reannealing will generate mismatches which are then cleaved by a detection enzyme. The bands are then analyzed by gel electrophoresis
- Flow Sorting: iPSC colonies will be dissociated using EDTA, and the cells will be sorted by a flow-cytometry machine
- Clonal Expansion: Individual stem cells will be expanded in specialized single-cell conditions using StemFlex media and RevitaCell. Isolated iPSC clones will be expanded following standard protocols
- Sangur Sequencing: After clonal expansion, the target region of the clones will be amplified using PCR. Then Sangur Sequencing will be used to verify if any of the clones had their genome modified by the point mutation
- Statistical Analysis: After a sufficiently large number of trials have occurred, the outcomes will undergo statistical analysis to determine if the results have any statistical significance
Timeline
- January-February: Electroporation of iPSCs and Analysis
iPSCs will be electroporated and allowed to expand. After expansion, cell counts will be used to determine if enough cells are alive to move to the next step. Several different combinations of gRNA, small molecules, and electroporation settings will be used. This step will be repeated several times.
- February-March: Flow Sorting and Clonal Expansion
After the electroporated iPSCs have expanded, they will be flow sorted into single cells and placed on new cultures. We will then wait for clonal expansion to take place until each of the single cells grows into a large enough sample to sequence.
- March-April: Sangur Sequencing and Comparison of Results
The efficiency of the HDR CRISPR inserting the point mutation will be tested by Sangur sequencing each of the individual cell cultures that expanded. If the point mutation was successfully inserted it will appear differently than the wild-type sequence.
- April-May: Statistical Analysis and Presentation
The project information will be combined and analyzed to determine a p-value. This will help determine statistical significance. Afterwards, I will prepare a presentation that clearly communicates the project information and conclusion. If the results of the project prove to be significant, I will discuss writing a formal paper to submit to a scientific journal with Dr, Tristani and Dr. Maguire.
Mentorship
This project is a collaboration between Dr. Tristani-Firouzi, his lab at the Nora Eccles Harrison Cardiovascular Research and Training Institute, Dr. Colin Maguire, the Cellular Translational Research Core, and myself. Dr. Tristani is a board-certified pediatric cardiologist as well as the principle investigator of a research program that is currently investigating the genetic, molecular, and cellular basis of inherited arrhythmia syndromes. As my faculty mentor, Dr. Tristani provides a wealth of knowledge and experience. Once a week, Dr. Tristani and I will meet to discuss experimental results, new data, and the general progress of the project. During these meetings he will be able to give me advise on how to continue and offer his unique perspective of the information gathered. For more day-to-day guidance, I will rely on Dr. Maguire who is an expert in iPSC technology. After the conclusion of the project, I will present my findings to both Dr. Tristani and Dr. Maguire so that they can give me feedback on my communication skills and help me improve my project presentation.
Education and Future Goals
Currently, I am on track towards earning a B.S in Biomedical Engineering from the University of Utah. After my undergrad, I plan to pursue a higher level education whether that be an M.D, Ph.D, or dual program combining the two. By participating in undergraduate research, I will be able to experience being a researcher and working in a lab first-hand. This project will teach me about foundational research practices and basic stem cell research techniques as well as introducing me to some of the latest advancements in biomedical engineering study. UROP will expand my skill set, helping me grow into an independent researcher and teaching me early on how to break down and study complex problems that effect people around the world.
I have always had a passion for both research and study of the human body. The future of scientific improvement lies in the collusion of researchers from different disciplines. As a Biomedical Engineer, I hope to combine knowledge from all areas of study and work towards breakthroughs in medicine, science, and engineering. Specifically, I hope to continue researching stem cells and their potential use in regenerative medicine and tissue engineering. This career is about expanding knowledge and then applying that knowledge in a way that helps others. Upholding these ideals with lead down a path that challenges me as well as gives me personal fulfillment, and I believe that UROP is one of the first steps on the path.
