Forensic Science is a science that help in investigation process, and actually is the main part of it. DNA was first isolated by Swiss chemist Friedrich Miescher in 1869, then its molecular structure was first identified by James Watson and Francis Crick in 1953 based on data which left from English Chemist and X-ray crystallographer Rosalind Franklin. Forensic scientists use blood, semen, skin, saliva, urine, and hair that found on crime scenes for identifying DNA and matching it with suspect’s data.
This process called DNA profiling, or DNA fingerprinting. DNA profiling was developed in 1984 by British scientist Alec Jeffreys. It is collection and analysing of VNTR(variable number tandem repeats) which unique sequences on the chromosomes that differ in number. These specific regions are found between genes and non coding, they consist of only about 1% of DNA, but this is enough to distinguish people from each other.
Since these regions vary highly among people, this difference called polymorphism. A DNA profile can tell the scientist if the DNA is from a man or woman, and if the sample being tested belongs to a particular person. In 1910 Edmond Locard established the first crime laboratory as a professor of forensic medicine at University of Lyons, France and is best known for his evidence transfer theory in forensic science, ‘The Locard’s Exchange Principle’. In 1918, he also first suggested the 12 point matching system for positive fingerprint identification.
127 our experts are availableright now
Thus, one way to produce a DNA profile is for scientists to examine STRs at 10 or more genetic loci. These genetic loci are usually on different chromosomes. STRs are short tandem repeats that contain repeating units, or microsatellites of the same nucleotide sequence. STR markers exhibit high variability in a population, so giving rise to high degrees of association of evidence with a suspect. For example, CAGTCAGTCAGTCAGTCAGT is an STR where the nucleotide sequence CAGT is repeated five times. Because of small size of those repeats, it makes STR much less sensitive to degradation of the DNA. Thousands of microsatellites have been identified and used for forensic science, medical, and commercial purposes.
There are different techniques for analysis, and they depend on factors such as cost, time, or amount of DNA sample. On of the useful technique that was adopted by Kary Mullis as automate process is PCR (polymerase chain reaction) because of accuracy and ability to use small amount of DNA. However, It has been used since 1970s for making copies(amplifying) of DNA when DNA is not enough for creating profiling. PCR involves three steps within a thermal cycler: denaturation under 95C when DNA denatures, and bonds between two strand break, resulting in single stranded DNA; annealing, when attachment of synthetic DNA(primers) to origin strand of DNA happens under 60C; extension occurs under 72C when single bases, one by one is added to the primer by polymerase named Taq (from bacterium known as Thermas Acquaticus).
So, the result is two identical double stranded DNA are produced in one cycle. Usually it needs 25-40 cycles, which takes about 3 hours. PCR method is very sensitive to contamination be foreign DNA. Thus, extraction has to be done in place that physically isolated from the place where amplification will be performed. (rasskazat podrobnee)
Since the introduction of DNA fingerprinting technology or DNA profiling in 1984, the extraction of DNA from human biological fluids (e.g. blood, saliva, semen) has become a daily occurrence in forensic DNA labs worldwide. Over the years, the technology to extract DNA has become even more sophisticated. DNA is often in the news, but one of the most recent stories included a new term: touch DNA.
Although it’s new to the media, touch DNA has been in existence for several years. Touch DNA can be obtain from skin, or epithelial cells after the person touches objects. These cells may be found victim’s clothes at crime scene, for example, or on the weapon. Touch DNA can be obtained with a type, or swabbed with Q-tip, or even scraped. Source of scraped DNA is food for example. A little amount of skin cells, such as 5 to 20 are needed to have touch DNA sample
. Touch DNA analysis is commonly used to gain information from biological materials to aid investigations associated with criminal offences, disaster victim and missing people identification, so it has been an effective investigative tool. As the significance value of DNA profiling to forensic investigations has increased, generation of information from smaller amounts of DNA is crucial. With the technology of today, the simple act of picking up an object or touching a surface can lead to the identification and apprehension of a criminal. Touch DNA is also called as Contact Trace DNA. Touch DNA is not to be confused with “Low Copy Number” DNA, or enhanced PCR methods. (rasskazat ob etom, why).
Various Touch DNA sampling techniques have been used at the crime scene and in forensic laboratories worldwide for over a decade. The number of cells transferred to touched objects is highly variable, and often results in less than 300 picograms of DNA. These cells are typically recovered when force is used such as on victim’s clothes or at a crime scene after a struggle has occurred. This opened up possibilities and led to the collection of DNA from a wider range of exhibits (including: tools, clothing knives, vehicles, firearms, food, bedding, condoms, lip cosmetics, wallets, jewellery, glass, skin, paper, cables, windows, doors and stones).
Many crime scene investigators and laboratories test for Touch DNA using either the wet/ dry swabbing or cutting methods. When the swabbing method is utilized, the surface of the item is usually rubbed with a wet cotton swab, followed by a dry cotton swab in an effort to collect possible skin cells. The wet/dry swabbing method is recommended for hard, non-porous items such as metal, glass or plastic, and can easily be performed at the crime scene with limited risk of contamination with exogenous DNA (e.g. from the person collecting the sample, or from nearby surfaces/ objects). The cutting method may be used for soft items, such as clothing, in which fabric from areas of interest is cut to collect possible cells.
These two approaches can be successful on many items of evidence; however, they both have the limitation of placing unnecessary substrate (the cotton swab itself or the fabric cuttings) into the small DNA processing tube. There is a limited amount of substrate that can be placed in a tube, and the substrate itself may “trap” some cells during processing, decreasing the likelihood of obtaining results. In addition to the commonly used swabbing and cutting methods, several laboratories also use the Scraping [15-17]. and Tape Lift methods [18], in which the surface of soft/porous items are either scraped with a sterile scalpel blade, or sampled with a small piece of Scotch Tape, or the adhesive portion of a Post-It Note, to collect possible skin cells.
The analyst utilizing the scraping or tape lift method will focus their sampling to an area of damage, or the area where the perpetrator is believed to have had the most contact. Through the use of these sampling methods, an area approximately the size of an adult’s hand can be sampled. The scrapings/tape/Post-it notes are then placed directly in the extraction tube. Labs use pre-treated tape (usually exposed to a UV Cross-linker) and will also process a blank piece of tape alongside the evidence sample to ensure that no DNA has been introduced via adventitious contamination from the manufacturer.
It should be noted that adhesives can be problematic during the DNA extraction procedure and as such, the investigator must ensure that their lab of choice has a validated extraction procedure that can successfully remove the adhesive without affecting the DNA yield. The scraping and tape lift methods allow a larger surface area to be sampled as opposed to the cutting method. An increase in surface area increases the chances of recovering more skin cells, which increases the chances of obtaining a DNA profile.
The first step in collecting trace samples is to identify which areas to target. By and large, trace samples on surfaces are not readily identifiable. While fingerprinting agents are used to identify touched areas on some exhibits, many exhibits are swabbed or tape lifted based on assumptions about where the DNA-containing material is located. The use of non-invasive detection systems would be ideal. Touched surfaces that have been revealed using fingerprinting methodologies are usually those surfaces on which fingerprints are sought as the priority, rather than surfaces where DNA will be sampled. There are exhibit materials yielding successful DNA profiles using PCR STR typing:
- Arm-rest (automobile)
- Apple core–bite marks
- Baseball cap (brim)
- Binder twine
- Bottle cap
- Chocolate bar (handled end)
- Cigarette lighter (disposable/striker and body)
- Cigarette paper
- Cigarette butts
- Dime
- Doorbell, door pull
- Drug syringe barrel exterior
- Electrical cord
- Envelopes
- Hold-up note
- Ignition switch
- Keys
- Knife handles
- Lipstick (top surface and outer surface of lipstick case)
- Paper
- Pen
- Plastic bag handles
- Remote car starter
- Rope
- Screwdriver handle
- Seat belt buckle (automobile)
- Shoe laces
- Steering wheels
- Toothbrush
Investigator needs to consider the potential evidentiary value of the DNA. The investigator must take into account the relationship between the victim and the suspect (if one exists), and any possibility of “innocent transfer” of DNA that may have occurred before the alleged crime. and either lived with, or had recent contact with the victim, then finding the suspect’s DNA on the evidence may be of limited probative value. Touch DNA can easily be transferred throughout the household via day-to-day interactions, contact with furniture items/bedding, or through the laundry.
